ID: 1132746120_1132746135

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1132746120 1132746135
Species Human (GRCh38) Human (GRCh38)
Location 16:1437016-1437038 16:1437059-1437081
Sequence CCGAGGGCCCGTGGGGGCTGTTC GGAGGCAGGGCAGGCCCCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 162} {0: 1, 1: 1, 2: 6, 3: 117, 4: 980}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!