ID: 1132746122_1132746134

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1132746122 1132746134
Species Human (GRCh38) Human (GRCh38)
Location 16:1437024-1437046 16:1437056-1437078
Sequence CCGTGGGGGCTGTTCCGACCACA GAGGGAGGCAGGGCAGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95} {0: 1, 1: 0, 2: 27, 3: 208, 4: 1545}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!