ID: 1132884896_1132884921

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1132884896 1132884921
Species Human (GRCh38) Human (GRCh38)
Location 16:2178360-2178382 16:2178405-2178427
Sequence CCTAGAGCCCTTGGAGCCCCCGG CCCGGCCCGGGTCCAGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 283} {0: 1, 1: 1, 2: 2, 3: 50, 4: 442}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!