ID: 1132884907_1132884916

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1132884907 1132884916
Species Human (GRCh38) Human (GRCh38)
Location 16:2178379-2178401 16:2178399-2178421
Sequence CCGGCCAGGCGGTCCCCGGTGGG GGGCGCCCCGGCCCGGGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 143} {0: 1, 1: 0, 2: 2, 3: 44, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!