ID: 1132884907_1132884918

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1132884907 1132884918
Species Human (GRCh38) Human (GRCh38)
Location 16:2178379-2178401 16:2178401-2178423
Sequence CCGGCCAGGCGGTCCCCGGTGGG GCGCCCCGGCCCGGGTCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 143} {0: 1, 1: 0, 2: 1, 3: 12, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!