|
Left Crispr |
Right Crispr |
| Crispr ID |
1132905849 |
1132905860 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:2282617-2282639
|
16:2282658-2282680
|
| Sequence |
CCCTGGGCACCACCTCTGCTCAG |
AGCCCCACATCCCCTCCTCCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 2, 2: 3, 3: 28, 4: 316} |
{0: 5, 1: 1, 2: 5, 3: 86, 4: 518} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|