ID: 1132934931_1132934944

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1132934931 1132934944
Species Human (GRCh38) Human (GRCh38)
Location 16:2475312-2475334 16:2475361-2475383
Sequence CCGGCCACGCGCGGGTTGGGGGC GCAGCTGCGGCTTGGCCTACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 105} {0: 1, 1: 0, 2: 2, 3: 12, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!