ID: 1132934941_1132934948

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1132934941 1132934948
Species Human (GRCh38) Human (GRCh38)
Location 16:2475353-2475375 16:2475367-2475389
Sequence CCGGCGCTGCAGCTGCGGCTTGG GCGGCTTGGCCTACGGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 279} {0: 1, 1: 0, 2: 0, 3: 2, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!