ID: 1133325082_1133325100

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1133325082 1133325100
Species Human (GRCh38) Human (GRCh38)
Location 16:4937249-4937271 16:4937291-4937313
Sequence CCGAGGAGGGGCCACCGCGCGGG TGGGGACACTGGGTCTTGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 164} {0: 1, 1: 1, 2: 1, 3: 28, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!