ID: 1133325089_1133325097

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1133325089 1133325097
Species Human (GRCh38) Human (GRCh38)
Location 16:4937263-4937285 16:4937280-4937302
Sequence CCGCGCGGGCGGGGCTTGGACGC GGACGCGGGGGTGGGGACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 84} {0: 1, 1: 0, 2: 11, 3: 54, 4: 462}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!