ID: 1133451897_1133451908

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1133451897 1133451908
Species Human (GRCh38) Human (GRCh38)
Location 16:5910841-5910863 16:5910893-5910915
Sequence CCAGGAAAGCTCCCTGTTCCGTG ACATCCCTCATCCTCTGGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!