ID: 1133834306_1133834318

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1133834306 1133834318
Species Human (GRCh38) Human (GRCh38)
Location 16:9352352-9352374 16:9352393-9352415
Sequence CCCCAAACACACAAATCTTCTCT GCTGGGGGTTGGGAGAGGAGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!