ID: 1134057791_1134057796

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1134057791 1134057796
Species Human (GRCh38) Human (GRCh38)
Location 16:11181261-11181283 16:11181279-11181301
Sequence CCAGTCCAGACAGGACACGCTGG GCTGGGCCCCTGGCATCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 109} {0: 1, 1: 0, 2: 4, 3: 39, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!