ID: 1134057797_1134057807

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1134057797 1134057807
Species Human (GRCh38) Human (GRCh38)
Location 16:11181285-11181307 16:11181312-11181334
Sequence CCCCTGGCATCCAGAGGAAGAGC AGTGTGGGAAGGCCCACAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 214} {0: 1, 1: 0, 2: 2, 3: 13, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!