ID: 1134057798_1134057810

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1134057798 1134057810
Species Human (GRCh38) Human (GRCh38)
Location 16:11181286-11181308 16:11181320-11181342
Sequence CCCTGGCATCCAGAGGAAGAGCC AAGGCCCACAGTGGGGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 236} {0: 1, 1: 1, 2: 2, 3: 57, 4: 464}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!