ID: 1134143620_1134143634

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1134143620 1134143634
Species Human (GRCh38) Human (GRCh38)
Location 16:11742804-11742826 16:11742850-11742872
Sequence CCCCAATCCCGCAGCTCGCCGCA TCAGCCGCGCCGCCGCCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44} {0: 1, 1: 0, 2: 1, 3: 14, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!