ID: 1134406241_1134406249

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1134406241 1134406249
Species Human (GRCh38) Human (GRCh38)
Location 16:13961438-13961460 16:13961478-13961500
Sequence CCCATGTCCTCAGCTGTTCGGAT GTTTCGAGGAGTGGTGTCAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!