ID: 1134407165_1134407177

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1134407165 1134407177
Species Human (GRCh38) Human (GRCh38)
Location 16:13970604-13970626 16:13970641-13970663
Sequence CCCACTCCCAGTGCACAGATTCT CACTGCTGGGGGAAGGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 22, 3: 130, 4: 911}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!