|
Left Crispr |
Right Crispr |
| Crispr ID |
1134447289 |
1134447297 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:14340525-14340547
|
16:14340574-14340596
|
| Sequence |
CCTCAGCCTTCCGAGTAGCTGGA |
GCTAACTTTTTTTAGAGACAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 160, 1: 7698, 2: 127221, 3: 300783, 4: 216507} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|