ID: 1134494840_1134494850

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1134494840 1134494850
Species Human (GRCh38) Human (GRCh38)
Location 16:14724704-14724726 16:14724749-14724771
Sequence CCCCACCCAGTGGGGCCCCCATC TCCGTATTTGTAATAGCAAATGG
Strand - +
Off-target summary {0: 9, 1: 0, 2: 18, 3: 14, 4: 289} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!