ID: 1134759151_1134759162

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1134759151 1134759162
Species Human (GRCh38) Human (GRCh38)
Location 16:16698234-16698256 16:16698280-16698302
Sequence CCCCTCCCCTGTGCCCCTGGGTT GAGACAAATGCTTATGAGTGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 77, 4: 516} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!