ID: 1134945198_1134945210 |
View in Genome Browser |
Spacer: 23 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1134945198 | 1134945210 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 16:18319546-18319568 | 16:18319592-18319614 |
| Sequence | CCCATTTGCTATTACAAATACGG | GATGGGGGCCCCACTGGGTGGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 9, 1: 0, 2: 18, 3: 14, 4: 289} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||