ID: 1134968238_1134968247

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1134968238 1134968247
Species Human (GRCh38) Human (GRCh38)
Location 16:18509165-18509187 16:18509189-18509211
Sequence CCTCGCCATCTCTGAGCAGTGGG GGAAATGGAAGAACAGGGACTGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 2, 3: 9, 4: 186} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!