ID: 1135203905_1135203912

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1135203905 1135203912
Species Human (GRCh38) Human (GRCh38)
Location 16:20465681-20465703 16:20465710-20465732
Sequence CCGAGTGCCTGAGTGGTGGCTGG TGGGCTGCATTCGAGCAGGTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 24, 4: 257} {0: 2, 1: 0, 2: 0, 3: 11, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!