ID: 1135204758_1135204765

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1135204758 1135204765
Species Human (GRCh38) Human (GRCh38)
Location 16:20474100-20474122 16:20474133-20474155
Sequence CCTAAAATGTATAAAACCAAGGT CAATTTGGGCACGTGTTCTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 77, 3: 586, 4: 948}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!