ID: 1135386285_1135386291

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1135386285 1135386291
Species Human (GRCh38) Human (GRCh38)
Location 16:22043875-22043897 16:22043919-22043941
Sequence CCAAGACTGGGTAATTTATAAAG ACAGTTCCACGTGACTGGGGAGG
Strand - +
Off-target summary No data {0: 45, 1: 1158, 2: 6120, 3: 7523, 4: 6990}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!