ID: 1135607346_1135607365

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1135607346 1135607365
Species Human (GRCh38) Human (GRCh38)
Location 16:23836069-23836091 16:23836117-23836139
Sequence CCCGGGTGCAGCAGCGGCCGCCG CCCGCGGTCCCGCGGCCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 60, 4: 437} {0: 1, 1: 1, 2: 4, 3: 40, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!