ID: 1135607350_1135607359

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1135607350 1135607359
Species Human (GRCh38) Human (GRCh38)
Location 16:23836089-23836111 16:23836109-23836131
Sequence CCGCCTCCCGCGCCTCCCCGGCC GCCCGCAGCCCGCGGTCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 217, 4: 1715} {0: 1, 1: 0, 2: 4, 3: 22, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!