ID: 1135607351_1135607375

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1135607351 1135607375
Species Human (GRCh38) Human (GRCh38)
Location 16:23836092-23836114 16:23836138-23836160
Sequence CCTCCCGCGCCTCCCCGGCCCGC GGCCGGCACCTCTCGGGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 18, 3: 195, 4: 1326} {0: 1, 1: 0, 2: 1, 3: 14, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!