ID: 1135607368_1135607384

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1135607368 1135607384
Species Human (GRCh38) Human (GRCh38)
Location 16:23836125-23836147 16:23836172-23836194
Sequence CCCGCGGCCCCGGGGCCGGCACC CAAGATGGCTGACCCGGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 481} {0: 1, 1: 0, 2: 0, 3: 4, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!