ID: 1135607377_1135607386

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1135607377 1135607386
Species Human (GRCh38) Human (GRCh38)
Location 16:23836146-23836168 16:23836174-23836196
Sequence CCTCTCGGGCTCCGGCTCCCCGC AGATGGCTGACCCGGCTGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 292} {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!