ID: 1135626000_1135626004

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1135626000 1135626004
Species Human (GRCh38) Human (GRCh38)
Location 16:23995473-23995495 16:23995507-23995529
Sequence CCATAATCCACAGATAGCTAGTT GACAGCTCTTGGCCTGCTACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 104} {0: 9, 1: 184, 2: 221, 3: 158, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!