ID: 1135962064_1135962071

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1135962064 1135962071
Species Human (GRCh38) Human (GRCh38)
Location 16:27003323-27003345 16:27003336-27003358
Sequence CCACCCTCCCACCAGGTGTCAAC AGGTGTCAACAGAGGCCAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 287} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!