ID: 1136271967_1136271979

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1136271967 1136271979
Species Human (GRCh38) Human (GRCh38)
Location 16:29153744-29153766 16:29153773-29153795
Sequence CCCCCTGGGGGCTCTGGGTCCTT GTACTCCCTCTGGGGGCTCTGGG
Strand - +
Off-target summary No data {0: 6, 1: 7, 2: 38, 3: 182, 4: 726}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!