ID: 1136316940_1136316946

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1136316940 1136316946
Species Human (GRCh38) Human (GRCh38)
Location 16:29460022-29460044 16:29460067-29460089
Sequence CCCTGCTCAGCTTGTGGCTCCAA GCCATCCCTGCCCTTTCCCATGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 0, 3: 16, 4: 143} {0: 2, 1: 0, 2: 3, 3: 47, 4: 385}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!