ID: 1136373551_1136373560

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1136373551 1136373560
Species Human (GRCh38) Human (GRCh38)
Location 16:29850930-29850952 16:29850983-29851005
Sequence CCAATCCATGCCTTGATGTCTCC GCTCTTGCCAATGAAATGCAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!