ID: 1136414845_1136414854

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1136414845 1136414854
Species Human (GRCh38) Human (GRCh38)
Location 16:30096580-30096602 16:30096599-30096621
Sequence CCCGTGAGGCCGTTTCTCCCGTT CGTTGGCTCCACTGTACCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76} {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!