ID: 1136641523_1136641536

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1136641523 1136641536
Species Human (GRCh38) Human (GRCh38)
Location 16:31569340-31569362 16:31569390-31569412
Sequence CCTGCGACGAGGGCGGCGGGCGC GCCCACCCGGCTCTTGGTCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 172} {0: 1, 1: 0, 2: 2, 3: 5, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!