ID: 1136641539_1136641549

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1136641539 1136641549
Species Human (GRCh38) Human (GRCh38)
Location 16:31569392-31569414 16:31569424-31569446
Sequence CCACCCGGCTCTTGGTCGCGGGG GCCGCGGCGGCCGCCACCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 57} {0: 1, 1: 0, 2: 20, 3: 152, 4: 526}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!