ID: 1136683878_1136683892

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1136683878 1136683892
Species Human (GRCh38) Human (GRCh38)
Location 16:31983103-31983125 16:31983155-31983177
Sequence CCTGCACAGAAGTGCCTTGAGAC GCCTGGGGTCTCTGCCAAGAGGG
Strand - +
Off-target summary No data {0: 5, 1: 0, 2: 2, 3: 32, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!