ID: 1136691984_1136691994

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1136691984 1136691994
Species Human (GRCh38) Human (GRCh38)
Location 16:32039273-32039295 16:32039288-32039310
Sequence CCAGGGGGCGCTCAGGACACTGG GACACTGGGGGGGGGTGTGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 76, 4: 1056}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!