ID: 1136691984_1136692001

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1136691984 1136692001
Species Human (GRCh38) Human (GRCh38)
Location 16:32039273-32039295 16:32039312-32039334
Sequence CCAGGGGGCGCTCAGGACACTGG GGGGGTCACAGAGAACCACAAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 1, 3: 32, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!