ID: 1136778910_1136778936

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1136778910 1136778936
Species Human (GRCh38) Human (GRCh38)
Location 16:32885368-32885390 16:32885418-32885440
Sequence CCGCCGGGTGTCCCCAGGCCCGC GTCGGGCCCGGGCGCGATGAGGG
Strand - +
Off-target summary No data {0: 3, 1: 1, 2: 0, 3: 4, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!