ID: 1136913303_1136913316

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1136913303 1136913316
Species Human (GRCh38) Human (GRCh38)
Location 16:34161146-34161168 16:34161191-34161213
Sequence CCATGACCCGCTGGGCAGCTTCC TTTAGGTTCCGGGGGGAGTACGG
Strand - +
Off-target summary {0: 7, 1: 8, 2: 1, 3: 20, 4: 188} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!