ID: 1136913305_1136913314

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1136913305 1136913314
Species Human (GRCh38) Human (GRCh38)
Location 16:34161153-34161175 16:34161183-34161205
Sequence CCGCTGGGCAGCTTCCAAGAAAC TTTGGGTTTTTAGGTTCCGGGGG
Strand - +
Off-target summary {0: 8, 1: 1, 2: 0, 3: 31, 4: 183} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!