ID: 1136993284_1136993289

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1136993284 1136993289
Species Human (GRCh38) Human (GRCh38)
Location 16:35170247-35170269 16:35170262-35170284
Sequence CCGCTGCCGCCGCGGGGCCCGGG GGCCCGGGACCCCGGCCACCCGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 28, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!