ID: 1137593167_1137593174

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1137593167 1137593174
Species Human (GRCh38) Human (GRCh38)
Location 16:49706321-49706343 16:49706358-49706380
Sequence CCAAAAGGATAGAGCCTTCAAGT CAGCCATGGCCACAGCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 114} {0: 1, 1: 0, 2: 7, 3: 61, 4: 523}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!