ID: 1137960266_1137960270

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1137960266 1137960270
Species Human (GRCh38) Human (GRCh38)
Location 16:52875853-52875875 16:52875874-52875896
Sequence CCTAGAGCCTTAATAGGGGGTTT TTTCTATATAGGGTAAAATTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 58, 4: 538}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!