ID: 1138197827_1138197830

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1138197827 1138197830
Species Human (GRCh38) Human (GRCh38)
Location 16:55066687-55066709 16:55066730-55066752
Sequence CCAAATGTTGGCGGAGGTGTGGA GCGCTGGTTGGAAAGTAAAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!