ID: 1138532916_1138532921

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1138532916 1138532921
Species Human (GRCh38) Human (GRCh38)
Location 16:57644979-57645001 16:57644992-57645014
Sequence CCCCCATGCACACACACATGCAC ACACATGCACACTCATGCATGGG
Strand - +
Off-target summary {0: 2, 1: 9, 2: 74, 3: 563, 4: 3109} {0: 2, 1: 3, 2: 17, 3: 80, 4: 508}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!